Лямблии у детей что это: Лямблиоз у детей – Юргамышская ЦРБ

Содержание

ВЫЯВЛЕНИЕ ЛЯМБЛИОЗА КИШЕЧНИКА У ДЕТЕЙ

Адреса клиник г. Казань

Адрес: ул. Гаврилова, 1, ост. «Гаврилова» (пр. Ямашева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 10, 10а, 18, 33, 35, 35а, 36, 44, 45, 46, 49, 55, 60, 62, 76

Троллейбус: 2, 13

Трамвай: 5, 6

Адрес: ул. Т.Миннуллина, 8а, (Луковского) ост. «Театр кукол»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобус: 1, 2, 31, 37, 47, 74

Троллейбус: 6, 8, 12

Метро: Суконная слобода

 

 

Адрес:
ул. Сыртлановой, 16, ст. метро Проспект Победы, ост. ул. Сыртлановой (проспект Победы)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 34, 37, 62 77

Трамвай: 5

Метро: Проспект Победы

Адрес: ул. Назарбаева, 10, ст. метро «Суконная Слобода», ост. «Метро Суконная Слобода»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 1, 4, 25, 43, 71

Метро: Суконная слобода

 

 

Адрес: ул. Декабристов, 180, ст. метро «Северный вокзал», ост. «Гагарина»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 6, 18, 29, 33, 37, 40, 43, 53, 62, 76, 78, 89

Троллейбус: 13

Трамвай: 1, 6

Метро: Северный вокзал

Адрес: пр. А.Камалеева, 28/9, (жилой комплекс «XXI век»), ост. «Новый ипподром»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Троллейбус: 3

 

 

Адрес: Дербышки, ул. Мира, 20, ост. «Магазин Комсомольский», «Гвоздика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 1, 19, 25, 34, 44, 60, 84

Адрес:
ул. Серова, 22/24, ост. «ул. Серова»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 10, 10а

 

 

Адрес: ул. Беломорская, 6, ст. метро «Авиастроительная», ост. «ул. Ленинградская»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 6, 18, 33, 37, 40, 42, 43, 53, 60, 78, 89, 93

Троллейбус: 13

Трамвай: 1

Метро: Авиастроительная

Адрес: ул. Закиева, 41а, ост. «Кабельное телевидение»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00 

Автобус: 5, 18, 30, 31, 34, 45, 46, 62, 63, 77, 89

Троллейбус: 3, 5, 9, 12

 

 

Адрес: ул. Кул Гали, 27, ост. «ул. Кул Гали» (ул. Габишева)

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной

Автобус: 46, 90

Адрес: ул. Рихарда Зорге, 95, м. «Дубравная», ост. «ул. Юлиуса Фучика»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: 8.00-14.00

Автобусы: 5, 18, 30, 31, 33, 34, 45, 68, 74, 77

Троллейбусы: 5, 9, 12

Трамвай: 4

Метро:

Дубравная

Адрес: ул. Фрунзе, 3а, ост. «Идель»

Пн-Пт: 7.00-20.00, Сб: 7.30-16.00, Вс: выходной 

Автобусы: 10а, 36, 49, 53, 63, 72, 106

Троллейбус:1

 

Что такое лямблии и чем они опасны для человека?

 Лямблии это одноклеточные гельминты, которые имеют микроскопические размеры. Обитают в организме у человека, млекопитающих, паразитируют в кишечнике, двенадцатипёрстной кишке, в жёлчном пузыре, в печени. Особенно опасны лямблии в печени. Есть 2 формы существования лямблий: Вегетативная – плоские паразиты грушевидной формы, размеры которых не превышают 0,02 мм. Паразитируют в тонком кишечнике и других органах пищеварения. Глисты активно передвигаются при помощи жгутиков, питаются остатками расщеплённой пищи и размножаются. Цисты

– споровая форма, при которой активная жизнедеятельность паразитов приостанавливается. Она необходима, чтобы длительное время сохранять жизнь глистам в неблагоприятных условиях. Вегетативная форма превращается в цисту, когда гельминты попадают в толстый кишечник, откуда выводятся во внешнюю среду. За пределами организма в капсулированном виде они живут месяцами, пока не попадут в тело нового носителя. Несмотря на небольшие размеры, эти гельминты наносят большой вред здоровью. Результатом их паразитирования становятся: нарушение процесса усвоения питательных веществ. Продукты жизнедеятельности лямблий негативно сказываются на работе эндокринной, нервной, сердечнососудистой  системе, поскольку паразиты влияют на состав крови. Часто возникают дерматологические заболевания. Возрастает риск развития астмы, снижается иммунитет, происходит потеря веса из-за ухудшения аппетита.

 Заражение лямблиями происходит, когда цисты попадают в организм через рот. Это может произойти 3 путями:

1- водный – при употреблении некипяченой водопроводной воды либо из природных источников.

2- Пищевой – через немытые либо необработанные термически продукты, в частности, фрукты, овощи.

3- Контактно-бытовой – при  контакте человека с животным, страдающим от лямблиоза и предметами, на которых были цисты. Для развития болезни достаточно, чтобы в организм попало 10 цист. Особенно подвержены инфицированию люди с пониженной кислотностью желудка.

Первые симптомы заболевания проявляются после заражения спустя 1-2 недели, когда паразиты начинают активно размножаться и их количество быстро увеличивается. Общим признаком инвазии является снижение веса. Другие – зависят от формы протекания болезни. Она бывает острой и хронической. Головная боль может сигнализировать о появлении лямблий

Симптомы острого лямблиоза. Острая форма заболевания продолжается 5-7 дней, но может затянуться на месяцы. Проявляется она такими симптомами: Повышенная утомляемость, раздражительность. Головные боли. Нарушения стула (запоры, поносы), метеоризм. Тошнота, возможно рвота. Резкое повышение температуры до 38°С. Боли в животе, локализуются в районе пупка. Ухудшение аппетита, чувство перенасыщения. Стремительная потеря веса. Появление сыпи на коже. От острой формы болезни чаще страдают дети. Если не начать лечение, лямблиоз переходит в

хроническую форму. Основные её признаки: Нарушения функционирования желудочно-кишечного тракта – вздутие живота, запоры либо поносы, метеоризм. Ухудшение цвета кожи, неравномерная её окраска, чрезмерная бледность лица. Высыпания на языке. Аллергические реакции, дерматиты. Чрезмерная сухость и шелушение каймы губ. Истощение нервной системы, нервозность, астения. Патологии жёлчевыводящих путей, застой жёлчи. Анорексия. Хронический лямблиоз сопровождается острой болью в животе. Люди могут быть носителями лямблий. В таких случаях их состояние здоровья не ухудшается, но для окружающих они являются источником заражения.

Симптомы лямблиоза у детей. Особенно опасен лямблиоз для детей. Самые характерные симптомы поражения у детей: отставание в физическом и интеллектуальном развитии, поскольку организм не получает нужные микроэлементы и витамины. Отказ от еды. Быстрое истощение. Повышенная температура до 37,5°С без других симптомов простуды, которая держится неделями. Постоянные поносы либо запоры. Скрежетание зубами во сне. Тянущие либо режущие боли в области живота. Постоянная вялость, пониженный тонус. Увеличенные лимфоузлы. Удушливый кашель. Лябмлии в организме приводят к ухудшению самочувствия и  нужно пройти диагностику, чтобы исключить инвазию лямблиями.

С целью подтверждения лямблиоза обязательно нужно провести лабораторный анализ. Курсы лечения назначаются строго врачом.

Профилактика.

Чтобы минимизировать риск заражения лямблиями, нужно соблюдать простые правила:

Тщательно мыть руки перед каждым приёмом пищи.

Пить лишь фильтрованную либо кипячёную воду.

Мыть фрукты, овощи.

Не купаться в водоёмах, где не предусмотрены пляжи.

Не грызть ногти.

Регулярно проводить антигельминтную профилактику домашним животным.

Необходимо приучать детей к соблюдению правил личной гигиены с раннего возраста.

При появлении признаков болезни  не заниматься самолечением, обращаться за медицинской помощью к врачу.

Помощник  энтомолога                                                       Куликовская Н.В.

Анализ на Антитела к лямблиям (Lamblia intestinalis), суммарные

Лямблии – простейшие, которые паразитируют в тонкой кишке человека и животных и вызывают лямблиоз. Они могут существовать в форме трофозоитов (активная форма) и в форме цист (покоящаяся форма). Если циста попадает в организм, из нее выходят трофозоиты, которые начинают активно размножаться в кишечнике. Часть трофозоитов вновь образует цисты, которые выделяются вместе с фекалиями.

Заразиться лямблиозом можно при употреблении немытых овощей, фруктов, а также через загрязненные руки, бытовые предметы и при контакте с фекалиями. Инкубационный период болезни составляет от 3 до 42 дней. Симптомы острой инфекции неспецифичны: боль, вздутие и урчание в животе, метеоризм, частый жидкий стул с неприятным запахом, повышенное количество непереваренных жиров в кале, иногда с потерей аппетита и рвотой. Также при лямблиозе наблюдаются аллергические дерматиты, артрит и ринит. Течение болезни может быть и бессимптомным.

Чаще всего лямблиозом болеют дети. К группе высокого риска также относятся путешественники, люди, не соблюдающие гигиену, пациенты с иммунодефицитами и мальабсорбцией, работники, чья деятельность связана с животными.

Для эффективной диагностики лямблиоза как взрослым, так и детям рекомендован анализ крови на антитела к лямблиям. В ответ на заражение иммунная система вырабатывает специфические антитела разных классов – иммуноглобулины A, M, G. IgM появляются уже на 14-й день после контакта с паразитом, затем начинается синтез IgG, которые остаются в крови до самого конца заболевания; их уровень снижается через 1-2 месяца после выздоровления. Анализ на суммарные антитела к лямблиям позволяет измерить суммарный уровень специфических иммуноглобулинов к лямблиям.

В каких случаях обычно назначают исследование?

  • При нарушениях стула
  • При хронических заболеваниях желудочно- кишечного тракта
  • При признаках кожных заболеваний или аллергической патологшии респираторного тракта
  • При обследовании лиц, контактировавших носителем лямблий

Что именно определяется в процессе анализа?

Проводится суммарное определение концентрации антител к лямблиям в крови методом ИФА (иммуноферментный анализ).

Что означают результаты теста?

В норме результат анализа на лямблиоз должен быть отрицательным. Положительный результат говорит о наличии антител к лямблиям, что может быть признаком текущей инфекции, недавно перенесенного заболевания или возможного бессимптомного носительства. Следует помнить, что отрицательные значения могут быть получены при отсутствии иммунного ответа (иммунодефицитные состояния) либо если с момента заражения прошло меньше 14 дней (серонегативный период болезни).

Сроки выполнения теста.

Результат исследования можно получить спустя 3-4 дня после сдачи анализа.

Как подготовиться к анализу?

Следует придерживаться общих правил подготовки к взятию крови из вены. Кровь можно сдавать не ранее, чем через 3 часа после приема пищи в течение дня, или утром натощак. Чистую воду можно пить в обычном режиме.

Giardia lamblia: основная паразитарная причина детской диареи у пациентов районной больницы в Гане | Паразиты и переносчики

  • Адаму Х., Эндешоу Т., Тека Т., Кифе А., Петрос Б. Распространенность кишечных паразитов. Ethiop J Health Div. 2006, 20 (1): 39-47.

    Google ученый

  • Noor Azian MY, San YM, Gan CC, Yusri MY, Nurulsyamzawaty Y, Zuhaizam AH, Maslawaty MN, Norparina I, Vythilingam I: Преобладание кишечных простейших в общине аборигенов в Паханге, Малайзия.Троп Биомед. 2007, 24: 55-62.

    КАС пабмед Google ученый

  • Dib HH, Lu SQ, Wen SF: Распространенность Giardia lamblia с диареей или без нее в Юго-Восточной, Юго-Восточной Азии и на Дальнем Востоке. Паразитол рез. 2008, 103 (2): 239-251. 10.1007/s00436-008-0968-6.

    Артикул пабмед Google ученый

  • Addy PAK, Antepim G, Frimpong EH: Преобладание патогенной Escherichia coli и паразитов у младенцев с диареей в Кумаси, Гана.E Afr Med J. 2004, 81 (7): 353-357.

    КАС Google ученый

  • Айех-Куми П.Ф., Куарку С., Квакье-Нуако Г., Кретчи Дж.П., Осафо-Кантанка А., Морту С. Распространенность кишечных паразитарных инфекций среди продавцов продуктов питания в Аккре, Гана. Дж Троп Мед Паразитол. 2009, 32 (1): 1-

    Google ученый

  • Nyarango RM, PA A, EW K, BO N: Риск патогенных кишечных паразитарных инфекций в муниципалитете Кисии, Кения.Общественное здравоохранение BMC. 2008, 8: 237-10.1186/1471-2458-8-237.

    Центральный пабмед Статья пабмед Google ученый

  • Supanaranond W, Migasena S, Pitisuttitham P, Suntharasamai P: Состояние здоровья тайских добровольцев, участвующих в испытании вакцины против холеры. J Med Assoc Thai. 1990, 73 (10): 548-

    CAS пабмед Google ученый

  • Wongjindanon N, Suksrichavalit T, Subsutti W, Sarachart T, Worapisuttiwong U, Norramatha P: Текущий уровень заражения Giardia lamblia в двух провинциях Таиланда.Общественное здравоохранение J Trop Med из Юго-Восточной Азии. 2005, 36 (прил. 4): 21-25.

    ПабМед Google ученый

  • Reither K, Ignatius R, Weitzel T, Seidu-Korkor A, Anyidoho L, Saad E, Djie-Maletz A, Ziniel P, Amoo-Sakyi F, Danikuu F: Острая детская диарея в северной Гане: эпидемиологические, клинические и микробиологические характеристики. BMC Infect Dis. 2007, 7 (1): 104-10.1186/1471-2334-7-104.

    Центральный пабмед Статья пабмед Google ученый

  • ВОЗ: Междисциплинарная консультация по разработке национальной программы безопасности пищевых продуктов.1992, том 19/E/L:1-2. ВОЗ

    Google ученый

  • Норхайати М., Фатмах М.С., Юсоф С. Кишечные паразитарные инфекции у человека: обзор. Med J Малайзия. 2003, 58: 2-10.

    Google ученый

  • Аль-Мехлафи М.С., Азлин М., Айни У., Шайк А., Сайя А., Фатмах М.С., Исмаил М.Г., Ахмад Фирдаус М.С., Айса М.Ю., Розлида А.Р.: Лямблиоз как предиктор недоедания в детстве у детей оранг-асли в Малазии.Trans R Soc Trop Med Hyg. 2005, 99 (9): 686-691. 10.1016/j.trstmh.2005.02.006.

    Артикул пабмед Google ученый

  • Verweij JJ, Oostvogel F, Brienen EAT, Nang Beifubah A, Ziem J, Polderman AM: Краткое сообщение: Распространенность Entamoeba histolytica и Entamoeba dispar в северной Гане. Троп Мед Int Health. 2003, 8 (12): 1153-1156. 10.1046/j.1360-2276.2003.01145.х.

    Артикул пабмед Google ученый

  • Адди П.А., Айкинс-Беко П.: Криптоспоридиоз у детей с диареей в Кумаси, Гана.Ланцет. 1986, 1 (8483): 735-

    CAS Статья пабмед Google ученый

  • Adjei O, Agbemadzo T, Addy PAK: Возникновение ооцист Cryptosporidium у ганских пациентов с диареей. E Afr Med J. 1987, 64: 108-113.

    КАС Google ученый

  • Adjei AA, Armah H, Rodrigues O, Renner L, Borketey P, Ayeh-Kumi P, Adiku T, Sifah E, Lartey M: Cryptosporidium spp., частая причина диареи у детей в клинической больнице Корле-Бу, Аккра, Гана. Jpn J Infect Dis. 2004, 57 (5): 216-219.

    ПабМед Google ученый

  • Аннан А., Кромптон Д.В.Т., Уолтерс Д.Е., Арнольд С.Е.: Исследование распространенности кишечных паразитов у детей дошкольного возраста в Гане. Паразитол. 1986, 92 (01): 209-217. 10.1017/S0031182000063563.

    Артикул Google ученый

  • [http://www.asanteakimnorth.ganadistricts.gov.gh]

  • ВОЗ: Основные лабораторные методы в медицинской паразитологии. 1991, Гевева: Всемирная организация здравоохранения

    . Google ученый

  • Аль-Хинди А.И., Эль-Кичаой А.: Возникновение желудочно-кишечных паразитов среди детей дошкольного возраста, Газа, Палестина. Журнал Исламского университета (серия естественных и технических наук). 2008, 16 (1): 125-130.

    Google ученый

  • Хейдари А., Рокни М.Б.: Распространенность кишечных паразитов среди детей в детских садах в Дамгане, Иран.Иранский J Public Health. 2003, 32 (1): 31-34.

    Google ученый

  • Shakkoury WA, Wandy EA: Распространенность инфекции Giardia lamblia в Аммане, Иордания. Пак J Med Sci. 2005, 21 (2): 199-201.

    Google ученый

  • Engels D, Nahimana S, Gryseels B: Сравнение прямого мазка фекалий и двух методов толстого мазка для диагностики кишечных паразитарных инфекций.Trans Roy Soc Trop Med Hyg. 1996, 90 (5): 523-525. 10.1016/S0035-9203(96)-1.

    КАС Статья пабмед Google ученый

  • Уотсон Б., Блитцер М., Рубин Х., Нахамкин И.: Прямые влажные препараты в сравнении с концентрацией для рутинного паразитологического исследования: необходимы ли оба? Ам Джей Клин Патол. 1988, 89 (3): 389-

    CAS пабмед Google ученый

  • Мелвин Д.М., Брук М.М., Национальное инфекционное заболевание C: Лабораторные процедуры для диагностики кишечных паразитов.1969 г., Национальный центр инфекционных заболеваний США, Лабораторный отдел, Секция лабораторных консультаций и разработок; для продажи Supt. документов., Правительство США. Распечатать. Off., Вашингтон (Атланта)

    Google ученый

  • Parija SC, Шриниваса Х: Точка зрения: Пренебрежение микроскопией кала на кишечные паразиты и возможные решения. Троп Мед Int Health. 1999, 4 (7): 522-524. 10.1046/j.1365-3156.1999.00434.x.

    КАС Статья пабмед Google ученый

  • Garcia LS: Практическое руководство по диагностической паразитологии.1999, Американское общество микробиологии

    Google ученый

  • Tay SCK, Gbedema SY, Gyampomah TK: Точность диагностики кишечных гельминтозов в справочной диагностической лаборатории в регионе Ашанти, Гана. Int J Исследование паразитов. 2011, 3 (1): 12-17.

    Артикул Google ученый

  • Эстевес Э.Г., Левин Дж.А. Исследование сохраненных образцов стула на наличие паразитов: нецелесообразность прямого влажного препарата.Дж. Клин Микробиол. 1985, 22 (4): 666-

    PubMed Central КАС пабмед Google ученый

  • Pearson RD: Последние сведения о геогельминтах: Ascaris lumbricoides, Hookworms, Trichuris trichiura и Strongyloides stercoralis. Curr Infect Dis Rep. 2002, 4 (1): 59-64. 10.1007/s11908-002-0068-1.

    Артикул пабмед Google ученый

  • Расо Г., Н’Горан Э.К., Марти Х.П., Утцингер Дж. Различия в микроскопической диагностике гельминтов и кишечных простейших среди диагностических центров.Eur J Clin Microbiol Infect Dis. 2006, 25 (5): 344-347. 10.1007/s10096-006-0135-х.

    Артикул пабмед Google ученый

  • Акуйоби К.Н., Огунсола Ф.Т., Ирегбу К.С., Одугбеми Т.О.: Сравнительная оценка прямого мазка кала и методов концентрации формольного эфира при идентификации видов Cryptosporidium. Ниг Дж. Здоровье и биомедицинские науки. 2005, 4 (1): 5-7.

    Артикул Google ученый

  • Всемирная организация здравоохранения: Основные лабораторные методы в медицинской паразитологии.1991, Женева: Всемирная организация здравоохранения. Женева

    Google ученый

  • Огунсанья Т.И., Ротими В.О., Аденуга А.: Исследование этиологических агентов детской диареи в Лагосе, Нигерия. J Med Microbiol. 1994, 40 (1): 10-10.1099/00222615-40-1-10.

    КАС Статья пабмед Google ученый

  • Traoré SG, Odermatt P, Bonfoh B, Utzinger J, Aka ND, Adoubryn KD, Assoumou A, Dreyfuss G, Koussémon M: отсутствие Paragonimus в группах высокого риска в Кот-д’Ивуаре, но значительная распространенность гельминтов и кишечные протозоотические инфекции.Паразиты и переносчики. 2011, 4: 96-10.1186/1756-3305-4-96.

    Артикул Google ученый

  • Абу-Мади М.А., Бенке Дж.М., Дойфоде С.Х.: Изменение тенденций кишечных паразитарных инфекций среди постоянных жителей и оседлых иммигрантов в Катаре. Паразиты и переносчики. 2010, 3: 98-10.1186/1756-3305-3-98.

    Артикул Google ученый

  • Каур Р., Рават Д., Каккар М., Уппал Б., Шарма В.К. Кишечные паразиты у детей с диареей в Дели, Индия.J Trop Med Public Health из Юго-Восточной Азии. 2002, 33 (4): 725-729.

    Google ученый

  • Хак Р., Рой С., Кабир М., Строуп С.Е., Мондал Д., Хоупт Э.Р. Сбор лямблий Инфекция и диарея в Бангладеш. J заразить Dis. 2005, 192 (12): 2171-2173. 10.1086/498169.

    Артикул пабмед Google ученый

  • Traub RJ, Inpankaew T, Reid SA, Sutthikornchai C, Sukthana Y, Robertson ID, Thompson RC: Циклы передачи Giardia duodenalis у собак и людей в общинах храмов в Бангкоке — критическая оценка ее распространенности с использованием трех диагностических испытания в полевых условиях при отсутствии золотого стандарта.Акта Тропика. 2009, 111 (2): 125-132. 10.1016/j.actatropica.2009.03.006.

    Артикул пабмед Google ученый

  • Хереси Г., Клири Т.Г.: Giardia. пед. обр. 1997, 18 (7): 243-10.1542/пир.18-7-243.

    КАС Статья Google ученый

  • Молекулярная и клиническая характеристика инфекции Giardia duodenalis у детей дошкольного возраста из Лиссабона, Португалия

    Giardia duodenalis является наиболее распространенной кишечной протозойной инфекцией, особенно у детей.В Португалии мало данных относительно этой инфекции у дошкольников. Настоящее исследование проводилось с апреля по июль 2009 года в государственных дошкольных учреждениях Лиссабона с участием 316 детей. Исследование стула проводили с помощью микроскопии. Молекулярный анализ был проведен во всех положительных образцах для G. duodenalis , чтобы определить сборку и подгруппу этого паразита. Восемь из обследованных детей дошкольного возраста (2,5%, 8/316) были инфицированы G. duodenalis .Кроме того, заразился и брат одного из инфицированных детей. Анализ генотипа, нацеленный на локусы ssu-rRNA и β giardin , выявил шесть заражений сборкой A и 3 – сборкой B. Определение подгруппы было возможно в четырех образцах, с тремя A2 и одним A3. Ограниченное число случаев исключало связь определенного симптома с комплексом. Представленные здесь данные показывают актуальность рассмотрения G.duodenalis у детей с кишечными жалобами даже в развитых странах.

    1. Введение

    Лямблиоз является широко распространенным кишечным заболеванием, вызываемым Giardia duodenalis . Этот простейший паразит имеет глобальное распространение, заражая людей и широкий круг млекопитающих-хозяев [1]. Распространенность лямблиоза у людей в развитых странах составляет 2–7% [2], тогда как в развивающихся странах она может варьировать от 20 до 30% [3].

    Спектр клинических проявлений лямблиоза человека относительно вариабелен: от отсутствия симптомов до острой или хронической диареи, обезвоживания, болей в животе, тошноты, рвоты и потери веса [4].Особенно страдают дети, с более тяжелыми последствиями, чем у взрослых. Однако влияние инфекции Giardia на развитие детей неясно. Некоторые исследования показали пагубное влияние на статус питания и ухудшение когнитивных функций у детей с лямблиозом [5–8], в то время как другие показали, что лямблиоз не влияет на рост детей [9]. Факторы хозяина, такие как иммунный статус, статус питания и возраст, признаны важными детерминантами тяжести инфекции [10].Однако исследования возможной связи между сообществами G. duodenalis и тяжестью заболевания до сих пор оказались противоречивыми [11].

    Молекулярные инструменты показали, что G. duodenalis представляет собой видовой комплекс, состоящий как минимум из восьми ассоциаций (A–H), среди которых только A и B были обнаружены для инфицирования человека [12].

    Предыдущие исследования были посвящены распространенности лямблиоза у детей дошкольного возраста (3-4%) [13, 14], определению ассоциаций G. duodenalis у человека [13, 15], животных и воды [15, 16] , а совсем недавно — о распространенности и факторах риска 90–128 G.duodenalis среди детей [17].

    Цель этого исследования состояла в том, чтобы определить, были ли какие-либо G. duodenalis у детей дошкольного возраста, наборы и их связь с клиническими данными из города Лиссабона.

    2. Материалы и методы
    2.1. План исследования, совокупность и выборка

    Поперечное исследование проводилось с апреля по июль 2009 г. Исследуемая популяция состояла из дошкольников (3306 детей), посещавших в этом году государственные дошкольные учреждения под надзором мэрии Лиссабона.Выбор детских садов, в которых проводилось исследование, был решен городскими властями Лиссабона с целью отражения более широкого социально-экономического положения семей и географического расселения детей. Количество вовлеченных детей составило 685 человек.

    В исследовании приняли участие 316 (46,1%, 316/685) детей дошкольного возраста в возрасте от 3 до 6 лет, посещающих выбранные детские сады сети государственных школ. К участию были приглашены все дети школ. Включенные дети были теми, чьи родители взяли образцы стула и подписали информированное согласие.

    2.2. Сбор образцов

    Перед сбором образцов была проведена встреча с директором каждой школы, а также с родителями для разъяснения целей исследования.

    Контейнеры для стула были доставлены родителям или опекунам в пятницу. Родителям/опекунам было приказано собрать три образца стула в течение нескольких дней без какой-либо фармакологической индукции и хранить их при температуре 4°C до утра понедельника, когда команда отправилась в школы, чтобы собрать все образцы.

    2.3. Микроскопия

    Образцы свежего стула были проверены на наличие G. duodenalis и других кишечных паразитов с помощью микроскопического анализа в физиологическом растворе, а также в йоде. Кроме того, метод концентрации формольного эфира также применялся для повышения чувствительности обнаружения. Все образцы были проверены тремя разными микроскопистами для перекрестной проверки результатов. Положительные образцы для G. duodenalis хранили в фильтровальной бумаге (набор для карт поколения, Qiagen) и хранили при температуре -20°C для дальнейшего анализа.

    2.4. Экстракция ДНК и ПЦР-амплификация

    ДНК экстрагировали из образцов, сохраненных в фильтровальной бумаге. Протокол выделения ДНК для высушенных пятен крови (набор для карт поколения, Qiagen) был адаптирован для образцов стула. Изменения в исходном протоколе включали утроение используемых объемов раствора, за исключением конечной стадии элюирования (100  мк л) [18]. Для некоторых образцов ДНК реэкстрагировали с использованием объемов элюирования 25  мкл л. Все образцы амплифицировали с использованием праймеров, нацеленных на малую субъединицу рибосомной РНК ( ssu-рРНК ) [19, 20] и β -гиардин ( bg ) локусов [21, 22].

    Реакции амплификации проводили с использованием 2  мкл л ДНК-матрицы в конечном объеме 25  мкл л с использованием PCR-шариков illustra PuReTaq Ready-To-Go (GE Healthcare, Великобритания). В каждую серию реакций ПЦР включали как положительный (ДНК, выделенный из штамма Portland-1 (ATCC 30888DLGC Promochem), так и отрицательный контроль (без добавления матрицы). Продукты ПЦР визуализировали на 2% агарозном геле, окрашенном бромистым этидием.

    2,5 Анализ последовательности

    Для анализа последовательности продукты ПЦР очищали с использованием набора JETQUICK Gel Extraction Spin Kit/50 (Genomed, Германия) в соответствии с инструкциями производителя.Реакции секвенирования ДНК проводили в обоих направлениях с использованием праймеров GiarF/GiarR для фрагмента гена ssu-рРНК (175  п.н.) [20] и описанных ранее [22] для фрагмента гена β -giardin гена (511  п.н.). . Последовательности, полученные в этом исследовании, были сопоставлены с ранее опубликованными последовательностями изолятов G. duodenalis , доступными в базе данных GenBank, с использованием ClustalW.

    2.6. Клинические данные и лечение

    Родитель или опекун каждого участника заполнял анкету для клинических данных относительно детей.

    Все дети, инфицированные G. duodenalis , находились под наблюдением педиатра Клиники тропических болезней Института гигиены и тропической медицины и лечились от инфекции метронидазолом в дозе 15 мг/кг/день, разделенной на три суточных дозы, на семь дней. Через три недели после лечения были получены новые образцы стула для подтверждения эффективности лечения. Если ребенок был заражен каким-либо кишечным паразитом, остальных членов домохозяйства приглашали собрать их стул, который также проверяли на наличие кишечных паразитов.

    2.7. Этические соображения

    Настоящее исследование было представлено и одобрено Комитетом по этике Института гигиены и тропической медицины, Лиссабон. Письменное информированное согласие было получено от всех родителей или законных опекунов детей, участвующих в исследовании.

    3. Результаты
    3.1. Паразитологические результаты

    Из 316 детей, участвовавших в этом исследовании, 166 (52,5%) были мальчиками и 150 (47,5%) девочками. Средний возраст был 5 лет.03 в возрасте от трех до шести лет. G. duodenalis был единственным патогенным паразитом, обнаруженным в фекалиях. цист G. duodenalis были обнаружены в 8 из 316 исследованных при микроскопии образцов (2,5%), что соответствует четырем школам, включенным в данную работу. Кроме того, один член семьи (брат) одного из инфицированных детей также был инфицирован G. duodenalis .

    3.2. Генотипирование Характеристика

    Девять положительных образцов на G.duodenalis были успешно амплифицированы для гена фрагмента ssu-рРНК , а для гена bg были амплифицированы только семь образцов (77,8%, 7/9) (рис. 1 и 2).



    Ssu Последовательности рРНК , полученные в этом исследовании, сравнивали с гомологичными последовательностями, найденными в GenBank, с помощью BLAST. Шесть образцов относятся к комплексу А и три к В (табл. 1). Последовательности, полученные для гена bg , также сравнивали с общедоступными последовательностями из GenBank с помощью BLAST.Кроме того, последовательностей bg были проанализированы на различение подгрупп в соответствии с генетическими полиморфизмами, описанными в другом месте [23]. Изоляты 3, 4 и 5 относятся к субкомплексу А2, а другой изолят (6) — к субкомплексу А3 (табл. 1).

    9047 Na 2 60400 6 5.8

    Case Возраст (лет) Школа Присутствуют симптомы Медицинский осмотр Сборки
    SSU бг

    1 5.8 Musgyira (JI77) Отсутствие аппетита Брюшная полости B
    2 4,8 Horta Nova Без симптомов Наблюдаются Без симптомов A Na
    3 3 6.0 6.0 Мюжельство MOTALENCE Нормальный A 0 A2
    4 * 9.5 9.5 Horta Nova Боли в животе при глубокой пальпации и вздутии живота А А2
    5 6.3 Alto Da Faia Боли в животе, отсутствие аппетита A2 A2
    6
    60400 6 6.3 Alto Da Faia No Symptoms Наблюдаются Allare A A3
    7 7 3.9 Ameixoeira Нет симптомов Наблюдается Нормальный B
    8
    8
    Ameixoeira Нет симптомов Наблюдается Нормальный Б**
    9 4.3 ameixoeira Без симптомов наблюдается

    Этот дети был членом семьи (брат) участника 3.
    ** Было невозможно выделить подтип комплекса B из-за наблюдаемого высокого уровня полиморфизма.
    NA: без усиления.
    NI: не идентифицирован. Несмотря на успешную амплификацию гена bg , этот образец не обладал достаточным качеством для секвенирования.

    Для оставшихся двух изолятов, 7 и 8, принадлежащих к комплексу B, не удалось определить соответствующий субкомплекс из-за высокой вариабельности нуклеотидов, наблюдаемой на хроматограмме.

    Новые образцы стула были собраны у всех инфицированных детей после полного лечения и проанализированы. При микроскопии паразитов не обнаружено.

    3.3. Клинические данные

    На момент взятия образца стула только четверо детей сообщили о симптомах (1, 3, 4, 5), включая отсутствие аппетита, боль в животе и метеоризм (таблица 1).

    Случай номер 9, случай перемежающейся диареи, был единственным случаем умеренной недостаточности питания (ИМТ 12; −2 < z-показатель < −3).

    Медицинское обследование у четырех детей (3, 6, 7 и 8) было нормальным. У остальных пяти наблюдались вздутие живота и болезненность при глубокой пальпации (табл. 1).

    3.4. Генетическая сборка и клиническая картина

    Из трех детей, инфицированных G. duodenalis сборкой B, у двоих было нормальное медицинское обследование без симптомов (7 и 8), в то время как у другого (1) наблюдалось вздутие живота и отсутствие аппетит как симптом.Из шести детей, инфицированных комплексом А, у двоих было нормальное медицинское обследование (3 и 6), а у троих симптомы отсутствовали (2, 6 и 9). Все эти результаты описаны в Таблице 1.

    4. Обсуждение

    Количество детей, инфицированных G. duodenalis в этом исследовании (8/316; 2,5%), было аналогично другим исследованиям, проведенным в Северной и Центральной Португалия, где были инфицированы 3%, 3,7% и 1,9% соответственно [13, 14, 17]. Эти результаты согласуются с сообщениями о распространенности этого паразита в развитых странах [12].

    Использование микроскопии в качестве единственной диагностической процедуры для обнаружения G. duodenalis можно рассматривать как ограничение данного исследования. Однако использование трех образцов стула позволяет обнаружить более 90% инфекции [24], что очень похоже на чувствительность экспресс-тестов, о которых недавно сообщалось [25], в то время как один образец стула позволяет обнаружить от 60 до 80 %, а анализ двух проб стула позволит выявить от 80 до 90% [24]. В этом исследовании было получено не менее двух образцов стула у всех детей и три образца у более чем 80% включенных в исследование детей.Кроме того, микроскопия имеет дополнительное преимущество, позволяя обнаруживать других кишечных паразитов [26].

    В нашем исследовании группа A встречалась чаще, с шестью изолятами, в то время как группа B была обнаружена у трех детей, что является противоположной картиной, зарегистрированной во всем мире, где группа B встречается чаще [11, 12]. Определение подгруппы было возможно только для образцов, положительных по совокупности А, поскольку образцы В было невозможно подтипировать из-за наличия двойных пиков в определенном положении на хроматограмме.Сообщалось о трудности субтипирования сборки B [18, 27]. Возможность определения подтипа особенно актуальна, когда необходимо отследить источник инфекции или когда для терапевтического контроля обязательно проведение различия между реинфекцией и новой инфекцией. Например, в этом исследовании два брата были инфицированы одной и той же подгруппой (A2) G. duodenalis , что указывает на общий источник инфекции.

    Другим интересным материалом, полученным в ходе этой работы, было обнаружение ребенка (случай 9) с недостаточностью питания (умеренной), что является обычной ситуацией в развивающихся странах [6].Этот ребенок также соответствует единственному ребенку, жалующемуся на периодическую диарею. В этом случае хроническая инфекция могла повлиять на состояние питания ребенка.

    Несмотря на растущий интерес к молекулярной характеристике G. duodenalis , по-прежнему отсутствует четкая связь между совокупностью и клиническим исходом, что приводит к противоречивым результатам. Исследование, проведенное в Нидерландах, выявило сильную корреляцию между группой А и легкой перемежающейся диареей и группой В с тяжелой и стойкой диареей [10].Другие исследования, проведенные в Эфиопии и Саудовской Аравии, также предполагают корреляцию между наличием симптомов и заражением скоплением [28, 29]. С другой стороны, исследование, проведенное в Австралии, показало, что у детей, инфицированных изолятами G. duodenalis из группы А, вероятность развития диареи в 26 раз выше, чем у детей с группой В [20]. В поддержку этих результатов другие работы в Бангладеш и Испании также показали статистическую связь между группой А и симптоматическими инфекциями, а также между группой В и бессимптомными инфекциями [30, 31].Что касается Португалии, то данные, полученные Sousa et al. [15] подтверждает, что G. duodenalis , принадлежащий к группе А, тесно связан с симптоматическими случаями. В соответствии с этим другая работа выявила более высокую распространенность сборки B у бессимптомных детей [13]. Ни у одного из детей, участвовавших в исследовании, не было диареи на момент взятия образца стула. Однако из четырех детей с симптомами при зачислении трое были инфицированы подгруппой А2 с более выраженными симптомами по сравнению с другими детьми с симптомами, носителями группы В.

    5. Выводы

    В этом исследовании были получены новые и актуальные данные об эпидемиологии лямблиоза в Португалии и поставлен вопрос о том, что группа В встречается чаще, чем группа А, что в конечном итоге позволяет предположить, что в развитых странах обнаруживается другой эпидемиологический профиль. Тот факт, что брат инфицированного ребенка также был инфицирован, усилил важность тестирования ребенка или члена семьи; если положительный, то все домохозяйство должно быть обследовано.Исследование не показало связи между наблюдаемой клинической картиной и совокупностями. Небольшое количество детей, инфицированных G. duodenalis , не оправдывает необходимость постоянного запроса на паразитологический анализ кала. Однако особое внимание следует уделять детям с абдоминальными жалобами, учитывая, что у 4/9 инфицированных детей были симптомы.

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов.

    Благодарности

    Авторы выражают благодарность Розалии Варгас, заместителю мэра Лиссабона по вопросам образования, за разрешение и поддержку этой работы; всем директорам участвующих детских садов за их поддержку; и Лора Краво за техническую помощь.

    Границы | Рециркуляция группы A Giardia lamblia после лечения метронидазолом в области с группами A, B и E Симпатрическая циркуляция

    Введение

    Giardia lamblia представляет собой жгутиковое простейшее, инфицирующее тонкий кишечник широкого спектра млекопитающих-хозяев.Передается фекально-оральным путем, что тесно связано с плохими санитарными условиями. Согласно недавним исследованиям, более 183 миллионов человек инфицированы Giardia в мире (Torgerson et al., 2015).

    Филогенетически G. lamblia делится на восемь сообществ, обозначенных в алфавитном порядке от A до H. Люди в основном заражаются сообществами A и B (Adam, 2001; Feng and Xiao, 2011; Cacciò et al., 2018). Присутствие комплекса E также было обнаружено, хотя и с гораздо меньшей частотой, чем A и B (Fantinatti et al., 2016; Скалиа и др., 2016; Захеди и др., 2017). Специфические характеристики каждой из различных групп повышают вероятность уникальных факторов, связанных с вирулентностью, патогенезом и чувствительностью к лекарственным средствам. Однако, поскольку инфекция часто протекает бессимптомно, диагностика и лечение инфицированных людей могут быть затруднены.

    В Бразилии основным классом препаратов, рекомендуемых для лечения лямблиоза, является 5-нитроимидазол. Несмотря на свою эффективность, препараты 5-нитроимидазола имеют ряд побочных эффектов (Gardner and Hill, 2001).Наиболее часто используемым препаратом является метронидазол из-за его низкой стоимости и легкого доступа. Хотя лечение метронидазолом, по-видимому, эффективно при большинстве инфекций, появляются доказательства увеличения частоты терапевтической неудачи (Tejman-Yarden and Eckmann, 2011; Leitsch, 2015). В Лондоне, Соединенное Королевство, сообщалось о чрезмерном росте персистирующей паразитарной инфекции после лечения 5-нитроимидазолом за период с 2008 по 2013 год, когда число случаев неэффективности лечения увеличилось с 15.от 1 до 40,2% (Nabarro et al., 2015). Это очевидное увеличение можно объяснить рядом причин, таких как неадекватные дозировки, неполные схемы лечения, иммуносупрессия или лекарственная устойчивость (Lemée et al., 2000; Gardner and Hill, 2001; Nash et al., 2001; Escobedo et al., 2014).

    В Бразилии инфекция Giardia распространяется по всей стране, и предполагаемая точечная распространенность может достигать более 50% в районах с социальной и санитарной уязвимостью (Coelho et al., 2017). Это указывает на то, что скорость передачи паразита высока.С другой стороны, на сегодняшний день случаи персистирующей инфекции неизвестны. Мы предполагаем, что биологические характеристики каждой из циркулирующих групп могут влиять на их обнаруженную заболеваемость и чувствительность к лекарственным средствам. Настоящее исследование было предпринято для изучения циркуляции групп G. lamblia в районе с высокой распространенностью инфекции после лечения паразитированных особей метронидазолом.

    Материалы и методы

    Сбор проб, диагностика и лечение паразитов

    Исследование проводилось в детском саду, расположенном в экономически неблагополучном районе Рио-де-Жанейро, Бразилия.В общей сложности 194 ребенка в этом детском саду в возрасте от 10 месяцев до 4 лет были обследованы в течение 2 лет. Ребенок был включен в исследование только после того, как родитель принял приглашение к участию и подписал Условия свободного и осознанного согласия, которые были одобрены Институциональным советом по этике (номер CAAE: 19705613.9.0000.5248) и включали полное раскрытие преимуществ и рисков. . У каждого пациента был собран один первоначальный образец стула для диагностики геогельминтов и простейших.Образцы фекалий подвергались паразитологическому исследованию по методикам Ритчи и Като-Каца. Кроме того, была проведена молекулярная диагностика с помощью ПЦР для выявления присутствия ДНК Giardia (см. ниже).

    Лица с положительным диагнозом на патогенные паразиты получали лечение в соответствии с рекомендациями Министерства здравоохранения Бразилии. При инфекциях, вызванных Giardia , пациентам назначали метронидазол в дозе 15 мг/кг/сут перорально (максимум 250 мг) в течение 5 или 7 дней в случае неэффективности лечения.Примерно через 20–35 дней после лечения брали новый образец для определения контроля излечения. Лица, у которых оставался положительный результат, подвергались второму циклу лечения метронидазолом, а затем повторно оценивались через 20 дней (второй контроль лечения). Методология диагностики образцов вылеченного контроля была такой же, как и при первом исследовании.

    Экстракция ДНК и молекулярная характеристика

    G. lamblia

    Образцы хранились при температуре -20°C до проведения молекулярной диагностики и характеризации.Выделение ДНК из кист проводили непосредственно из стула с помощью мини-набора QIAamp DNA Stool (Qiagen, Германия), в основном в соответствии с инструкциями производителя. Двумя исключениями были температура лизиса, которая была увеличена до 95°C, и объем буфера АЕ, используемого для элюирования ДНК, который был уменьшен до 100 мкл. Выделенную ДНК хранили при -20°С до момента использования.

    Для генотипирования G. lamblia использовали области консервативных генов, кодирующих глутаматдегидрогеназу ( gdh ) и бета-гиардин (β -gia ).Экстрагированную ДНК подвергали ПЦР и гнездовой ПЦР (вторичной ПЦР) в конечном объеме 50 мкл реакции, содержащей 1X ПЦР-буфер, 3 мМ MgCl 2 , 2,5 ед. ДНК-полимеразы Taq (Invitrogen Life Technologies, Бразилия), 200 мкМ трифосфатдезоксирибонуклеотидов dNTP (Invitrogen Life Technologies, Бразилия) и по 0,2 мкМ каждого праймера.

    Для амплификации мишени gdh в первичной ПЦР использовали праймеры: GDH 1 (TTCCGTRTYCAGTACAACTC) и GDH 2 (ACCTCGTTCTGRGTGGCGCA), а во вторичной ПЦР: GDh4 (ATGACYGAGCTYCAGAGGCACGT) и GDh5 (GTGGCGCARGGCATGATGCA), согласно Cacciò et., 2008. Для амплификации мишени β -gia использовали праймеры в первичной ПЦР: G7 (AAGCCCGACGACCTCACCCGCAGTGC) и G759 (GAGGCCGCCCTGGATCTTCGAGACGAC) и во вторичной ПЦР: B-GIAF (GAACGAACGAGATCGAGGTCCG) и B-GIAR (CTCGACGAGCTTCGTGTT), согласно Cacciò et al., 2002 и Lalle et al., 2005, соответственно.

    В качестве положительного контроля использовали экстракты ДНК из аксенических культур клона С6 штамма WB G. lamblia (АТСС 50803). Отрицательные контроли включали ДНК, выделенную из аксенных культур Entameba histolytica и Trichomonas vaginalis .Успешную амплификацию проверяли электрофорезом в агарозном геле при концентрации 1%.

    продукта ПЦР для каждой пары праймеров очищали с помощью набора NucleoSpin Gel and PCR Clean-up (Macherey-Nagel, Германия) в соответствии с инструкциями производителя, за исключением времени инкубации в буфере NE, которое было увеличено до 5 мин. Очищенные продукты секвенировали в обоих направлениях в трех экземплярах с использованием набора BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, США).После осаждения реакции образцы анализировали в службе секвенирования платформы для секвенирования ДНК FIOCRUZ (Otto et al., 2007). Каждый эксперимент проводили в трехкратной повторности.

    Полученные электрофореграммы были проанализированы на качество в программе Chromas 2.4. Характеристика последовательности была выполнена с использованием основного инструмента поиска локального выравнивания с использованием нуклеотида (BLASTn), и консенсус был получен с помощью программы сборки последовательности CAP3. Нуклеотидные последовательности gdh и β -gia из G.lamblia выравнивали по алгоритму CLUSTAL W (Thompson et al., 1994) в пакете Molecular Evolutionary Genetics Analysis (MEGA) 7.0 (Kumar et al., 2016).

    Филогенетический анализ был выполнен с использованием программы MEGA 7.0, а используемая оценка расстояния была основана на уравнении Jin and Nei (1990) с использованием 2-параметров модели Kimura). Последовательности новых изолятов в клинических образцах были выровнены с использованием последовательностей GenBank G. lamblia , принадлежащих наборам A, B и E.В качестве внешних групп использовались последовательности из G. psittaci , G. muris и T. vaginalis . Соответствующие инвентарные номера последовательностей указаны между вертикальными чертами на филогенетических деревьях. Кроме того, последовательности фрагментов гена gdh и β -gia были конкатенированы, и сообщалось о начальной загрузке выше 60%.

    Было построено

    филогенетических деревьев с использованием алгоритма объединения соседей (Saitou and Nei, 1987). Наилучшая статистическая модель была определена по наименьшему значению BIC, найденному в MEGA (Kumar et al., 2016), где для обоих генов был выбран параметр Kimura 2. Для каждой конструкции достоверность каждой ветви определялась доверительным пределом с помощью бутстрап-анализа (1000 повторений) (Felsenstein, 1985). Характеристика последовательности G. lamblia , полученная из GenBank и использованная в качестве эталона для построения филогенетического дерева генов gdh и β -gia , представлена ​​в дополнительной таблице 2.

    Программное обеспечение Recombination Detection Program версии 4 (RDP4) использовалось для проверки событий рекомбинации в наших изолятах из клинических образцов с использованием выравнивания конкатенированных последовательностей для генов gdh и β -gia (Martin et al., 2015). Существование уникальных событий рекомбинации было подтверждено несколькими методами (RDP, GENECONV, BootScan, MaxiChi, Chimera, SiScan и 3Seq).

    Оценка последовательности нуклеотидов в

    G. lamblia Трофозоиты, постоянно подвергавшиеся воздействию метронидазола in vitro

    Трофозоиты Giardia lamblia из клона W6, штамм WB [ATCC50803], культивировали при 37°C в среде TYI-S-33 с pH 7,0, дополненной 10% инактивированной эмбриональной телячьей сыворотки (Cultilab, Campinas, Бразилия).Трофозоиты постоянно подвергались воздействию метронидазола (МТЗ) (Sigma Chemical Co., Сент-Луис, США) в течение как минимум 16 недель. Экспериментальные группы определяли по концентрации воздействия МТЗ: 1-я группа (МТЗ5) – 5 мкМ; группа (MTZ10) 2, 10 мкМ; группа 3 (MTZ20), 20 мкМ; группа 4 (СМТЗ) – без воздействия метронидазола; и группа 5 (CDMSO), обработанная 0,05% диметилсульфоксидом (Sigma, США), наполнителем для разбавления МТЗ. Концентрацию, необходимую для ингибирования роста паразитов на 50% (IC 50 ), определяли с использованием методологии, описанной Bénéré et al., 2007. Анализы для каждой экспериментальной группы проводились в трех экземплярах, и результаты IC 50 определялись с использованием программного обеспечения Prism 6.0 (GraphPad;). Тест ANOVA использовался для статистического анализа.

    В конечной точке ДНК трофозоитов G. lamblia экстрагировали с использованием ДНКазола (1 мл/10 7 паразитов; Invitrogen, Карлсбад, Калифорния, США). Последовательности gdh и β -gia были получены и проанализированы, как описано выше.

    Результаты

    Частота

    Гс.lamblia Заражение и определение устойчивости паразитов после лечения

    Всего было взято 194 образца стула у детей, 109 женщин и 85 мужчин. При первом обследовании обнаружены следующие паразиты: Ascaris lumbricoides (15/194 – 7,73%), Entameba histolytica/dispar (4/194 – 2,06%), Entameba coli (5/194 – 2,58%). ), Endolimax nana (13/194 — 6,70%) и G. lamblia (86/194 — 44,33%) (дополнительная таблица 1).Всех индивидуумов, положительных на G. lamblia , лечили метронидазолом, и после лечения 36 человек оставались в исследовательской группе для оценки. Девятнадцать случаев представляли собой стойкую инфекцию после лечения и прошли второй цикл лечения метронидазолом. При определении второго контроля излечения повторно оценивали 18 человек. Из них у пятнадцати все еще был положительный диагноз на G. lamblia (рис. 1). Эти случаи индивидуально отслеживались для других клинических подходов.

    Рисунок 1. Схематическое изображение положительности на Giardia lamblia в образцах фекалий детей в разные периоды исследования. Количество образцов, полученных в течение трех оценочных моментов исследования ( Giardia ПЦР-отбор, 1-й контроль отверждения и 2-й контроль отверждения). Gia–: Образцы с отрицательным диагнозом на Giardia с помощью ПЦР; Gia+: Образцы с положительным диагнозом на Giardia с помощью ПЦР.

    Генотипирование

    G.lamblia , циркулирующие у дошкольников до и после лечения

    ДНК G. lamblia , выделенная от 86 детей с положительным результатом при первоначальном диагнозе, была генотипирована с использованием как gdh , так и β- gia в качестве мишеней. Мы наблюдали большую генетическую изменчивость среди изолятов из образцов. Из консенсусных последовательностей образцы были сгруппированы следующим образом: 40 изолятов в наборе A, 21 изолят в наборе B, 17 изолятов в наборе E и 4 изолята, демонстрирующих характеристики обоих наборов A и E (рис. 2, 3).Многие различия наблюдались в подкомплексах, характеризующих AI и AII.

    Рисунок 3. Филогенетическое дерево изолятов Giardia lamblia , собранных у детей до и после лечения, с помощью алгоритма объединения соседей с использованием двухпараметра Кимуры. (A) Филогенетическое дерево, основанное на последовательностях гена глутаматдегидрогеназы . (B) Филогенетическое дерево, основанное на последовательностях гена бета-гиардина .Последовательности названий обозначаются их инвентарными номерами. Красный ромб: CC1: изолировать из образца первого контроля отверждения и CC2: изолировать из образца второго контроля отверждения.

    После первого контрольного обследования 36 диагностированных случаев все еще были положительными на инфекцию Giardia и были повторно оценены. На основании первоначального определения группы набора 19 изолятов были из набора А, 5 изолятов из набора В, 9 изолятов из набора Е и 3 изолята из набора А/Е.После второго курса лечения 13 из 19 детей с набором А, 2 из 5 детей с набором В, 2 из 9 детей с набором Е и 2 из 3 детей с набором А/Е оставались положительными. Генотипирование показало, что 18 из них были сгруппированы как сборка А (таблица 1, рисунок 3 и дополнительный рисунок 1). Любопытно, что сборки B или E не были обнаружены среди положительных людей (рисунок 2 и дополнительный рисунок 1).

    Таблица 1. Giardia lamblia Совокупности, обнаруженные при первой диагностике и после лечения.

    Среди лиц, инфицированных комплексом А (11 субъектов) при первой оценке и в первом контроле лечения, 9 изолятов демонстрировали 100% идентичность между изолятами из образцов до и после лечения для двух использованных генных мишеней ( gdh и β – gia ). Три человека представили генотипическую дивергенцию между изолятами из первой проанализированной оценки и первого контрольного лечения. Два показали различия в гене β -gia , а другие показали различия в мишени gdh .

    После 2-го курса лечения 15 случаев оставались положительными, при этом 13 изолятов были сгруппированы в группу А, что включало идентификацию уникальной группы. Все последовательности из второго контроля лечения показали 100% идентичность с последовательностью того же индивидуума в первом контроле лечения.

    Три образца, которые были положительными после лечения, один из 1-й контрольной группы лечения и два из 2-й контрольной группы лечения, были амплифицированы, но не охарактеризованы.Три других изолята были генотипированы только на основе гена gdh .

    Среди лиц, которые представили изоляты, сгруппированные как набор А, в первом исследовании и в последующих контрольных лечениях, 8 случаев показали 100% идентичность изолятов во все три момента анализа.

    При использовании RDP4 количество возможных уникальных событий рекомбинации среди объединенных последовательностей различалось в зависимости от метода обнаружения (RDP: 13, GENECONV: 15, BootScan: 9, MaxiChi: 9, Chimera: 11, SiScan: 20, 3Seq: 19) .В области гена β -gia было обнаружено несколько событий рекомбинации (RDP: 0, GENECONV: 1, BootScan: 0, MaxiChi: 1, Chimera: 1, SiScan: 1, 3Seq: 2). Наибольшее количество рекомбинаций наблюдалось в области гена gdh (RDP: 13, GENECONV: 9, BootScan: 6, MaxiChi: 6, Chimera: 6, SiScan: 9, 3Seq: 13). Оба изолята сборки B и сборки E представили одно событие рекомбинации. Демонстрация одного и того же филогенетического профиля среди изолятов из каждого кластера сборки. Все другие события рекомбинации наблюдались в сборке А для мишени gdh.

    Никаких изменений в нуклеотидных последовательностях

    gdh и β -gia Из G. lamblia Трофозоиты не наблюдались после in vitro Воздействие метронидазола

    Значения IC 50 групп MTZ5, MTZ10 и MTZ20 были значительно выше, чем у контрольных групп SMTZ и CDMSO. Между группами не наблюдалось различий в нуклеотидных последовательностях (представлено Lopes-Oliveira et al.). Эти результаты показали, что, несмотря на серьезное влияние на выживание паразита, MTZ не вызывает изменений в оцениваемых консервативных генах.

    Обсуждение

    Передача G. lamblia более распространена в районах без элементарных санитарных условий (водоочистные и канализационные сети), что является реальностью в районах Бразилии с низким доходом. Внутривидовые и межвидовые контакты могут способствовать распространению лямблиоза (Feng and Xiao, 2011), что является реальностью в регионах с низким уровнем дохода, где кошки и собаки могут свободно бродить, а также может присутствовать домашний скот. Эти множественные источники могут увеличить риск заражения, наряду с повторным заражением G.lamblia и может объяснить высокую распространенность инфекции, наблюдаемую в настоящем исследовании. Однако неизвестно, связан ли профиль сборки Giardia с инфекционным бременем.

    Здесь были идентифицированы три группы G. lamblia (A, B и E), о которых сообщалось у людей. В нашем исследовании наблюдалась высокая скорость конвергенции между генами-мишенями ( gdh и β -gia ), использованными для генотипирования. Поскольку гены, используемые для генотипирования, считаются консервативными, ожидается хороший дискриминационный потенциал среди наборов (Ryan and Cacciò, 2013).Однако низкая вариабельность нуклеотидов, наблюдаемая среди субкомплексов А, ставит под сомнение эффективность этих генных мишеней для характеристики изолятов в основном в AI и AII (Lebbad et al., 2010, 2011; Ankarklev et al., 2018). Небольшие изменения нуклеотидов могут быть недостаточными или достаточными для дифференцировки в подгруппы. Используя метод обнаружения для выявления возможных уникальных событий рекомбинации, ген β -gia оказался более консервативным, чем ген gdh . Высокая скорость рекомбинации, наблюдаемая в сборке А гена gdh , указывает на высокую изменчивость среди изолятов этой сборки в этом исследовании.Это оправдывает расхождение в характеристиках субкомплексов AI и AII в генах-мишенях. Могли происходить события рекомбинации между подгруппами AI и AII и между ассоциациями A и E (Xu et al., 2012; Ankarklev et al., 2018). Мы обнаружили четыре случая несоответствия между наборами А и Е, но в этом исследовании не наблюдалось никаких событий рекомбинации. Обычно сообщается об этом несоответствии между комплексами (Cacciò et al., 2008).

    Частота сборки А была выше по сравнению с В или Е.Немногочисленные отчеты о сообществах Giardia в Бразилии указывают на региональные различия в распространенности преобладающего циркулирующего сообщества (Coelho et al., 2017). В Рио-де-Жанейро у людей чаще всего идентифицировали комплекс А (Volotão et al., 2007; Fantinatti et al., 2016), хотя набор B (Faria et al., 2016) и набор E (Fantinatti et al. , 2016) уже сообщалось. Настоящие результаты согласуются и подтверждают опубликованный эпидемиологический профиль скоплений Giardia в нашем регионе.

    В нашем предыдущем исследовании, проведенном в этом регионе, был идентифицирован комплекс E и особенно комплекс A (Fantinatti et al., 2016). Полученные здесь результаты показывают, что циркуляция этих сообществ все еще актуальна, а набор А распространяется в окружающей среде благодаря домашним животным (Volotão et al., 2007; Fantinatti et al., 2018). Однако идентификация комплекса В, циркулирующего в инфицированных детях, не была подтверждена, хотя первая идентификация комплекса В в Рио-де-Жанейро была зарегистрирована в тот же период (Faria et al., 2016). Дальнейшие исследования образцов окружающей среды могут помочь понять преобладание комплекса A.

    .

    В Бразилии наиболее часто используемым службой здравоохранения для лечения лямблиоза препаратом является метронидазол, и в большинстве случаев лечение оказывается эффективным. Однако фактическая частота терапевтической неудачи метронидазола в Бразилии до сих пор неизвестна. Наблюдаемая нами частота продолжающейся инфекции после лечения метронидазолом считалась высокой, поскольку 19 из 36 повторно обследованных детей были инфицированы при первом контроле лечения.Это продолжалось после второго контрольного лечения, где 15 из 18 были положительными. Положительные случаи в контроле лечения могут быть результатом терапевтической неудачи (субдоза препарата, резистентность к паразитам) или повторного заражения (Argüello-García et al., 2004).

    Отрицательные результаты лечения метронидазолом, скорее всего, являются терапевтическим успехом. Это событие наблюдалось у лиц, инфицированных тремя различными комплексами. Было высказано предположение, что определенная совокупность может быть связана с длительным течением лямблиоза и случаями сохранения инфекции после лечения (Mørch et al., 2008). Ни один из изолятов из контрольных образцов лечения не был генотипирован как группа B или E. Это может указывать на то, что лечение было эффективным для элиминации этих групп. Однако утверждать, что эти сборки (Б и Е) более чувствительны к действию МТЗ, чем группа А, нельзя. Поскольку клонирование генов в данном исследовании не проводилось, исключить коинфекцию нельзя и была выявлена ​​только одна ассоциация с помощью реакций секвенирования по SANGER.

    Поскольку в изучаемом сообществе плохие жилищные условия и плохие элементарные санитарно-гигиенические условия, основная гипотеза состоит в том, что случаи персистентных инфекций являются результатом последовательных инфекций.Это подтверждается теми случаями, когда совокупность, идентифицированная после цикла лечения, отличалась от первой оценки. Сборка А была единственной совокупностью, идентифицированной при 1-м и 2-м контроле отверждения. Учитывая высокую распространенность комплекса А в районе нашего исследования, наиболее вероятно, что повторное заражение будет именно этим комплексом. За исключением трех образцов, между последовательностями, оцененными до и после у одного и того же человека, наблюдалась 100% идентичность. Хотя повторное заражение той же ассоциацией не может быть исключено через короткий промежуток времени, в районе нашего исследования реинфекция была ожидаема примерно у половины детей, инфицированных ассоциацией В или Е в контроле лечения (по данным первого обследования).Это предполагает, что следует учитывать терапевтическую неудачу и резистентность.

    Как упоминалось выше, у трех человек, у которых после цикла лечения сохранялся положительный результат на комплекс А, наблюдалась генотипическая дивергенция между первым проанализированным образцом и первым контролем лечения. Изменения нуклеотидов, вероятно, не были следствием лечения, поскольку эти мишени не были изменены, когда трофозоитов Giardia подвергались воздействию различных концентраций MTZ in vitro.Это говорит о том, что эти люди были инфицированы другим штаммом того же комплекса, но с другим подтипом.

    Находки в районе нашего исследования позволяют предположить, что дети в течение длительного времени остаются инфицированными G. lamblia . Частые эпизоды повторного заражения и персистенции паразитов были замечательными открытиями в районе нашего исследования. В районах с высокой частотой заражения и реинфекции также ожидается частое применение метронидазола. Однако пока невозможно определить, были ли рецидивирующие случаи связаны с лекарственной устойчивостью паразитов.Продолжительное заражение паразитом Giardia может вызвать снижение уровня жирорастворимых витаминов и стеаторею, а также задержку роста. Воздействие лямблиоза на развитие ребенка усиливает серьезность этого типа инфекции как проблемы общественного здравоохранения, которая, хотя в основном незаметна и не привлекает внимания общественности, требует более пристального внимания. Настоящие результаты поднимают вопрос для районов с высокой частотой заражения: может ли лечение лямблиоза подвергать детей дополнительным неблагоприятным последствиям препарата, одновременно маскируя необходимость мер борьбы с паразитами, которые требуют изменений в государственной политике для поощрения инвестиций в улучшение санитарные условия.

    Заявление о доступности данных

    Наборы данных, представленные в этом исследовании, можно найти в онлайн-репозиториях. Названия репозитория/репозиториев и инвентарные номера можно найти в статье/дополнительных материалах.

    Заявление об этике

    Исследования с участием людей были рассмотрены и одобрены Этическим комитетом Института Освальдо Круза (CEP FIOCRUZ/IOC). Письменное информированное согласие на участие в этом исследовании было предоставлено законным опекуном/ближайшим родственником участников.

    Вклад авторов

    MF: концептуализация, методология, получение финансирования и написание рукописи. ЛЛ-О: методология. TC-F: методология. ПА-Т: методология. ЭВ: методология. АБ: формальный анализ. AD-C: концептуализация, получение финансирования и написание рукописи. Все авторы внесли свой вклад в статью и одобрили представленную версию.

    Финансирование

    Эта работа была поддержана внутренним финансированием Instituto Oswaldo Cruz (PAEF II-IOC-23-FIO-18-2-53), CNPq (Universal — 435015/2018-4).MF получил финансирование от Universal/CNPq (435015/2018-4). MF был поддержан стипендией от CAPES (Brasil Sem Miséria/Бразильская правительственная программа) и CNPq (PDJ). AD-C имеет исследовательскую стипендию от CNPq и FAPERJ (CNE).

    Конфликт интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

    Благодарности

    Мы глубоко благодарны Элизабет Сальгадо и команде детского сада за их безоговорочную поддержку в наборе детей, а также команде Clinica da Familia из CMS Heitor Beltrão-SMS-RJ за клиническую помощь.Мы в долгу перед доктором У. Провансом за его ценный критический обзор и издание на английском языке. Мы хотим поблагодарить Платформу секвенирования ДНК службы секвенирования — Fundação Oswaldo Cruz. Наконец, мы благодарны доктору Октавио Фернандесу за то, что он предоставил нам основу для этого направления исследований.

    Дополнительный материал

    Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2020.571104/full#supplementary-material

    .

    Сноски

    Каталожные номера

    Адам, Р.Д. (2001). Биология Giardia lamblia . клин. микробиол. Версия . 14, 447–475.

    Академия Google

    Анкарклев Дж., Леббад М., Эйнарссон Э., Франзен О., Ахола Х., Троелл К. и др. (2018). Новое мультилокусное типирование с высоким разрешением изолятов Giardia кишечной палочки сборки А выявило зоонозную передачу, клональные вспышки и рекомбинацию. Заразить. Жене. Эвол. 60, 7–16. doi: 10.1016/j.meegid.2018.02.012

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Аргуэльо-Гарсия, Р., Крус-Сото, М., Ромеро-Монтойя, Л., и Ортега-Пьеррес, Г. (2004). Изменчивость и вариабельность лекарственной чувствительности среди изолятов и клонов Giardia duodenalis , подвергшихся воздействию 5-нитроимидазолов и бензимидазолов in vitro . J. Антимикроб. Чемотер. 54, 711–721. doi: 10.1093/jac/dkh488

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Бенере Э., да Луз Р. А., Вермеерш М., Кос П. и Маес Л. (2007). Новый количественный метод микрокультуры in vitro для Giardia duodenalis трофозоитов. J. Microbiol. Методы 71, 101–106. doi: 10.1016/j.mimet.2007.07.014

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Cacciò, S.M., Beck, R., Lalle, M., Marinculic, A., and Pozio, E. (2008). Мультилокусное генотипирование Giardia duodenalis выявило поразительные различия между группами A и B. Int. Дж. Паразитол. 38, 1523–1531. doi: 10.1016/j.ijpara.2008.04.008

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Каччио, С.М., Де Джакомо М. и Позио Э. (2002). Анализ последовательности гена бета-гиардина и разработка анализа полиморфизма длины рестрикционного фрагмента полимеразной цепной реакции для генотипа цист Giardia duodenalis из образцов фекалий человека. Междунар. Дж. Паразитол. 32, 1023–1030. doi: 10.1016/s0020-7519(02)00068-1

    Полнотекстовая перекрестная ссылка | Академия Google

    Cacciò, S.M., Lalle, M., and Svärd, S.G. (2018). Специфичность хозяина в комплексе видов Giardia duodenalis . Заразить. Жене. Эвол. 66, 335–345. doi: 10.1016/j.meegid.2017.12.001

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Коэльо, Ч. Х., Дуриган, М., Леал, Д. А. Г., Шнайдер, А. Б., Франко, Р. М. Б., и Сингер, С. М. (2017). Лямблиоз как запущенное заболевание в Бразилии: систематический обзор публикаций за 20 лет. PLoS Негл. Троп. Дис. 11:e0006005. doi: 10.1371/journal.pntd.0006005

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Эскобедо, А.А., Ханевик К., Алмиралл П., Симерман С. и Альфонсо М. (2014). Ведение хронической инфекции Giardia . Эксперт Вер. Анти. Заразить. тер. 12, 1143–1157. дои: 10.1586/14787210.2014.942283

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Фантинатти М., Белло А. Р., Фернандес О. и Да-Крус А. М. (2016). Идентификация Giardia lamblia комплекса E у человека указывает на новый антропозоонозный цикл. Дж. Заражение.Дис. 214, 1256–1259. doi: 10.1093/infdis/jiw361

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Фантинатти, М., Касека, А.С., Белло, А.Р., Фернандес, О., и Да-Крус, А.М. (2018). Присутствие Giardia lamblia комплекса А у собак свидетельствует об антропозоонозном цикле паразита в Рио-де-Жанейро, Бразилия. Заразить. Жене. Эвол. 65, 265–269. doi: 10.1016/j.meegid.2018.07.025

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Фариа, К.П., Занини Г.М., Диас Г.С., да Силва С. и Соуза М.К. (2016). Молекулярная характеристика Giardia lamblia : первое сообщение о сборке B в человеческих изолятах из Рио-де-Жанейро (Бразилия). PLoS One 11:e0160762. doi: 10.1371/journal.pone.0160762

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Фельзенштейн, Дж. (1985). Пределы достоверности филогений: подход с использованием бутстрапа. Эволюция. 39, 783–791. дои: 10.2307/2408678

    Полнотекстовая перекрестная ссылка | Академия Google

    Гарднер, Т.Б., и Хилл, Д.Р. (2001). Лечение лямблиоза. клин. микробиол. Ред. 14, 114–128.

    Академия Google

    Джин Л. и Ней М. (1990). Ограничения эволюционно-экономного метода филогенетического анализа. Мол. биол. Эвол. 7, 82–102.

    Академия Google

    Кумар С., Стечер Г. и Тамура К. (2016). MEGA7: молекулярно-эволюционный генетический анализ версии 7.0 для больших наборов данных. Мол. биол. Эвол. 33, 1870–1874 гг. doi: 10.1093/molbev/msw054

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Лалле, М., Поцио, Э., Капелли, Г., Бруски, Ф., Кротти, Д., и Качио, С. М. (2005). Генетическая гетерогенность локуса бета-гиардин среди изолятов человека и животных Giardia duodenalis и идентификация потенциально зоонозных субгенотипов. Междунар. Дж. Паразитол. 35, 207–213. doi: 10.1016/j.ijpara.2004.10.022

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Леббад, М., Маттссон, Дж. Г., Кристенссон, Б., Юнгстрём, Б., Бэкханс, А., Андерссон, Дж. О., и соавт. (2010). От мыши к лосю: мультилокусное генотипирование изолятов Giardia от различных видов животных. Вет. Паразитол. 168, 231–239. doi: 10.1016/j.vetpar.2009.11.003

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Леббад, М., Петерссон, И., Карлссон, Л., Botero-Kleiven, S., Andersson, J.O., Svenungsson, B., et al. (2011). Мультилокусное генотипирование человеческих изолятов Giardia предполагает ограниченную зоонозную передачу и связь между комплексом B и метеоризмом у детей. PLoS Негл. Троп. Дис. 5:e1262. doi: 10.1371/journal.pntd.0001262

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Леме В., Захария И., Невез Г., Рабодонирина М., Брассер П., Балет Дж. Дж. и др. (2000). Чувствительность к метронидазолу и альбендазолу 11 клинических изолятов Giardia duodenalis из Франции. J. Антимикроб. Чемотер. 46, 819–821. doi: 10.1093/jac/46.5.819

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Мартин, Д. П., Мюррелл, Б., Голден, М., Хусал, А., и Мухире, Б. (2015). RDP4: обнаружение и анализ закономерностей рекомбинации в геномах вирусов. Эволюция вируса. 1:vev003.

    Академия Google

    Мёрх, К., Ханевик, К., Робертсон, Л.Дж., Странд, Э.А., и Лангеланд, Н. (2008). Лестница лечения и генетическая характеристика паразитов при рефрактерном лямблиозе после вспышки в Норвегии. Дж. Заражение. 56, 268–273. doi: 10.1016/j.jinf.2008.01.013

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Набарро, Л. Э., Левер, Р. А., Армстронг, М., и Чиодини, П. Л. (2015). Повышение заболеваемости лямблиозом, устойчивым к нитроимидазолу, в больнице тропических болезней, Лондон, 2008–2013 гг. клин. микробиол. Заразить. 21, 791–796. doi: 10.1016/j.cmi.2015.04.019

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Нэш, Т.Э., Ол, К.А., Томас, Э., Субраманиан, Г., Кайзер, П., и Мур, Т.А. (2001). Лечение больных рефрактерным лямблиозом. клин. Заразить. Дис. 33, 22–28. дои: 10.1086/320886

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Отто, Т. Д., Катаньо, М., Дегрейв, В., и де Миранда, А. Б. (2007). Платформа биоинформатики PDTIS: от последовательности к функции. Ред. Электрон. коммун. Инф. Инов. Сауде 1, 286–294.

    Академия Google

    Райан, У.и Cacciò, SM (2013). Зоонозный потенциал Giardia. Междунар. Дж. Паразитол. 43, 943–956.

    Академия Google

    Сайтоу, Н., и Ней, М. (1987). Метод соседнего соединения: новый метод реконструкции филогенетических деревьев. Мол. биол. Эвол. 4, 406–425.

    Академия Google

    Scalia, L.A., Fava, N.M., Soares, R.M., Limongi, J.E., da Cunha, M.J., Pena, I.F., et al. (2016). Мультилокусное генотипирование Giardia duodenalis у бразильских детей. Пер. Р. Соц. Троп. Мед. Гиг. 110, 343–349.

    Академия Google

    Томпсон, Дж. Д., Хиггинс, Д. Г., и Гибсон, Т. Дж. (1994). CLUSTAL W: повышение чувствительности прогрессивного множественного выравнивания последовательностей за счет взвешивания последовательностей, штрафов за пробелы для конкретных позиций и выбора матрицы весов. Рез. нуклеиновых кислот. 22, 4673–4680. дои: 10.1093/нар/22.22.4673

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Торгерсон, П.R., Devleesschauwer, B., Praet, N., Speybroeck, N., Willingham, A.L., Kasuga, F., et al. (2015). Оценки Всемирной организации здравоохранения глобального и регионального бремени 11 паразитарных болезней пищевого происхождения, 2010 г.: обобщение данных. PLoS Мед. 12:e1001920. doi: 10.1371/journal.pmed.1001920

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Волотао, А. К., Коста-Маседо, Л. М., Хаддад, Ф. С., Брандао, А., Перальта, Дж. М., и Фернандес, О. (2007). Генотипирование Giardia duodenalis из образцов человека и животных из Бразилии с использованием гена бета-гиардина: филогенетический анализ. Acta Trop. 102, 10–19. doi: 10.1016/j.actatropica.2007.02.010

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Сюй, Ф., Джерлстрём-Хультквист, Дж., и Андерссон, Дж. О. (2012). Полногеномный анализ рекомбинации позволяет предположить, что 90 128 ансамблей Giardia enteralis 90 129 представляют разные виды. Мол. биол. Эвол. 29, 2895–2898. doi: 10.1093/molbev/mss107

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Захеди, А., Филд Д. и Райан У. (2017). Молекулярное типирование Giardia duodenalis у людей в Квинсленде – первое сообщение о сборке E. Parasitology 144, 1154–1161. дои: 10.1017/s0031182017000439

    Резюме PubMed | Полный текст перекрестной ссылки | Академия Google

    Инфекции Giardia lamblia у детей, проживающих в детских домах


    Доктор Джейн Аронсон

    Giardia lamblia — наиболее распространенная протозойная болезнь, поражающая американцы сегодня.Мы часто видим это в кемперах и в детских садах. Родители детей в детских садах являются жертвами этого распространенного паразита, который заражает тонкий кишечник. Она явно связана с людьми, живущими в специализированных учреждениях и поэтому представляет интерес для родителей усыновление детей из-за границы. Дети со всего мира живут в детских домах находятся в группе риска по лямблиозу.

    Giardia вызывает различные симптомы, включая диарею, вздутие живота, хронические боли в животе и метеоризм.Стул может быть водянистым, но часто очень густые и бесформенные, большие по объему и с очень неприятным запахом. Некоторые люди имеют минимальные симптомы, но паразиты все еще выделяются. в их стуле и, следовательно, являются источником инфекции тех, кто находится в непосредственное окружение, например, их домашнее хозяйство. Прохождение бессимптомных кист надо лечить!

    Дети с лямблиями могут быть раздражительными и иметь поведенческие нарушения. Из-за мальабсорбции питательных веществ они могут не развиваться и страдать нарушение роста.Вероятно, это общая проблема для детей в детских домах.

    Легко обнаружить Giardia lamblia в стуле путем сбора кала на яйцеклетки и паразитов с особым вниманием к тестированию на лямблии антиген. Лучше всего получить по крайней мере три стула для оценки для Giardia, потому что цисты неравномерно отделяются.

    При усыновлении ребенка из-за границы кал на яйцеклетки и паразиты и Должен быть получен антиген Giardia.Затем, если есть кисты Giardia и/или антиген Giardia, ребенка следует лечить либо фуразолидоном, (Фуроксон) или Метронидазол (Флагил), назначенные врачом. Взрослые, приехавшие в страну происхождения ребенка, также должны быть оценивают на Giardia, если есть симптомы боли в животе и/или изменение режима работы кишечника. Смена подгузников младенцев и детей ясельного возраста всегда должно сопровождаться хорошими привычками мытья рук.Кисты лямблий легко передаются.

    Если у ребенка есть один паразит, нередко бывают и другие паразиты. После лечения лямблий необходимо получить последующую культуру. чтобы подтвердить ликвидацию инфекции, а также проверить, нет ли других паразитов. были раскрыты.

    Другие распространенные паразиты, обычно встречающиеся у детей, живущих в детских домах Cryptosporidium parvum , Entamoeba histolytica , Ascaris lumbricoides , Hymenolepis nana и Enterobius vermicularis (острицы).

    © Copyright Dr. Jane Aronson 2001


    Доктор Джейн Аронсон является сертифицированным генеральным директором педиатром, детским инфекционистом и клиническим Доцент кафедры педиатрии Медицинского колледжа Вейля Корнельского университета. Она является признанным специалистом в области медицины международного усыновления и имеет вылечили более 1400 детей, усыновленных из-за границы. Доктор Аронсон проводит предварительный осмотр медицинские отчеты, оценивает видео и фотографии, готовит людей к путешествию за границей, а также говорит и пишет о международном усыновлении для семейного усыновления группы, агентства по усыновлению и врачи.С ней можно связаться по адресу [email protected] или посетите ее веб-сайт www.orphandoctor.com

    Giardia lamblia – Центральный санитарный округ Контра-Коста

    Тематическое исследование

    Многие микроорганизмы могут претендовать на это звание. Болезнь какашек,   , то есть болезни что   может передаваться через человеческие отходы. Холера, брюшной тиф, дизентерия, кишечная палочка, список можно продолжить и На.

    На самом деле, некоторые из самых страшных вспышек болезней в истории человечества могут быть прослежены до нашей кормы.

    Однако, чтобы лучше понять передачу болезни через фекалии, хорошо иметь более простой и мягкий пример.

    Мы хотим, чтобы болезнь была одновременно и распространенной, и менее смертельный; так сказать, более дружелюбная болезнь какашек.

    Могу я предложить на ваше рассмотрение лямблию лямбию, вирус ответственный за Джарду. Передача болезней работает мало как это:

    Передача болезни

    Выпас животных, таких как коровы, свиньи, лошади или овечьи какашки.Этот какашки приземляются достаточно близко к реке, озеру или ручью, чтобы попадает в воду (и вирус лямблий вместе с Это).

    Ниже по течению люди могут пить из этой воды. Жители могут пить неочищенную колодезную воду. Путешественники и туристы могут пить неочищенная вода, взятая непосредственно из реки или ручья. Болезнь проникла в человеческий организм. Кроме того, так имеет немного экскрементов животных.

    Начало инфекции Giardia обычно происходит в течение недели. или так.Одним из характерных симптомов является то, что он вызывает инфицирование лица какать. Много. Иногда бесконтрольно. За дней или даже недель.

    Диагноз

    Именно тогда зараженный человек обычно попадает в больницу. врачу для постановки диагноза. Чтобы понять, что не так с пациентом, врач должен проверить….как вы уже догадались….их какать.

    Пациенты предоставляют образец стула, который затем анализируется на наличие вируса. Как правило, лечение включает отдых и увлажнение при потере жидкости.Это медицинский способ говоря: вам нужно какать это.

    Если бы эта какашка попала в необработанное тело воды, цикл начнется заново.

    Для более научного анализа лямблий есть много полезной информации ниже. Спасибо, что нашли время читать. Наслаждаться!

    История жизни

    Жизненный цикл

    Лямблии (Giardia lamblia) — анаэробные простейшие. Он движется мимо используя его жгутики, чтобы продвигать его по воде.

    Giardia выживает, колонизируя тонкую кишку некоторые позвоночные, особенно млекопитающие. лямблии это Известно, что они заражают людей.

    Впервые он был описан фон Левенгуком в 1681 г. исследовал собственный образец стула под микроскоп. Giardia не была признана болезнью патоген до 1970-х годов.

    Giardia lamblia существует в двух формах: активная форма, называемая трофозоит и неактивная форма, называемая кистой.

    Кисты имеют толстую клеточную стенку, которая защищает их от тепла и холода и позволяет им выживать в течение длительного времени во влажных среды.В необработанной холодной воде цисты Giardia может выжить в течение примерно 7 недель.

    Когда циста проглатывается хозяином, выделяются трофозоиты. в желудочно-кишечный тракт, где они размножаются и активно питание по всей пищеварительной системе.

    Трофозоиты превращаются в цисты по мере приближения к толстой кишке. они выделяются в окружающую среду с фекалиями хозяина и передается на другой хост.

    Микроскопическая Giardia lamblia имеет каплевидную форму и имеет размеры 9 – 21 микрометр в длину и 5 – 15 микрометров в ширину.

    Кисты лямблий имеют гладкие стенки, овальную форму, размером 8-8 мм. 12 микрометров в длину и 7-10 микрометров в ширину.

    Несколько видов Giardia заражают млекопитающих, в том числе собак, кошки, крупный рогатый скот, овцы, козы, свиньи, бобры, койоты, грызуны и еноты. Лямблии эндемичны для западных горных хребтов, Скалистые горы, Сьерра-Невада и Каскады.

    Здравоохранение

    Эпидемиология

    Лямблиоз очень заразен.Люди заражаются после контакта с зараженными пищевыми продуктами, почвой или водой, контактировали с фекалиями, переносящими Giardia.

    Проглатывание более 25 цист приводит к 100% заражению. всего 10 кист, способных передавать лямблии. Его наиболее распространены в районах с плохими санитарными условиями и небезопасной водой.

    Контакт от человека к человеку — это способ передачи №1. Вода трансмиссивная передача является вторым по значимости методом лямблиоза заражение в Соединенных Штатах при употреблении нефильтрованного вода из рек, ручьев, прудов и озер.

    Вспышки в Соединенных Штатах обычно связаны с небольшими водными системы с необработанной или недостаточно обработанной поверхностью воды. Инфекция наиболее распространена с июля по октябрь. Хотя Giardia поражает людей всех возрастов, дети в возрасте от 1 до 4 лет лет имеют самый высокий уровень заражения, а взрослые от 20 до 55 лет лет занимает второе место по заболеваемости.

    Симптомы

    Симптомы обычно проявляются через одну-три недели после заражения. Симптомы включают водянистую диарею, спазмы в животе, вздутие живота, тошнота, рвота, газы, плавающие или необычно вонючие стул, потеря веса, субфебрильная температура и потеря аппетита.Симптомы могут проявляться медленно, поскольку лямблии размножаются в организме. пищеварительная система вносит постепенные изменения в слизистую оболочку кишечник.

    Диагностика, лечение и профилактика

    Образцы стула берутся для анализа, чтобы определить, есть ли Giardia. настоящее время. В большинстве случаев гиадиса не требуется специального лечения. лечение. В острых случаях или стойких случаях антибиотики можно вводить лекарства.

    Люди могут заразиться, проглотив или придя при контакте с зараженными пищевыми продуктами, почвой или водой, зараженной фекалии инфицированного носителя.Правильная гигиена, мытье рук, санитарии и избегать потенциально зараженных продуктов питания и неочищенная вода является эффективным средством профилактики.

    Очистка и предотвращение сточных вод

    Удаление лямблий в сточных водах очистные сооружения и на построенных водно-болотных угодьях.

    Очистные сооружения с высоким содержанием песка фильтрация, ультрафильтрация и УФ-обеззараживание удалят и обеззараживание цист Giardia в очищенных сточных водах, Nasser el al., 2012.

    Высокоскоростная песчаная фильтрация, ультрафильтрация и УФ-обеззараживание признаны наиболее эффективными методами очистки сточных вод. для удаления и дезинфекции цист Giardia. Лечение водно-болотных угодий и пруды также могут быть эффективными.

    Источники:

    Каталожные номера

    1999. Герба, С.П., Томпсон, Дж.А., Фалаби, Дж.А., Ватт, П.М., и М.М. Капищак. Оптимизация дизайна искусственных водно-болотных угодий для удаления индикаторных микроорганизмов и патогенных простейшие.Wat. науч. Тех. 40, 363-368.

    2004. Карим, М.Р., Маншади, Ф.Д., Карписчак, М.М., и С.П. Герба. Персистенция и элиминация кишечных возбудителей в построены заболоченные участки. Вода Res. 38: 1831-37.

    2008. Рейносо Р., Торрес Л.А. и Э. Бекарес. Эффективность природных систем для удаления бактерий и болезнетворных паразиты из сточных вод. наук. Общая окружающая среда., 395(2-3):80-86.

    2012. Насер А.М., Вайзель-Охайон Д., Ахарони А. и М.Ревхун. Распространенность и судьба цист Giardia в сточных водах очистные сооружения. Дж. Применить. микробио. 113(3):477-84

    Сайтов:

    Википедия — Бесплатная энциклопедия: Giardia — Википедия

    Центр контроля заболеваний: Паразиты – Лямблии: Лямблии | Паразиты | CDC

    Научный блог, медицинский MS Аспирант: жизнь Под микроскопом: Giardia lamblia | Мой вид науки

    Гарвардская школа общественного здравоохранения: лямблиоз – Гарвардское здоровье

    Информация EPA о Giardia: GIARDIA: ИНФОРМАЦИОННЫЙ БЮЛЛЕТЕНЬ О ПИТЬЕВОЙ ВОДЕ

    Медскейп: Лямблиоз: Справочная информация, патофизиология, этиология

    Центр продовольственной безопасности и общественного здоровья; штат Айова Университет, колледж ветеринарной медицины: лямблиоз

    Построены водно-болотные угодья в Южной Аризоне: ALN Нет.45: Построенные водно-болотные угодья в Южной Аризоне

    Лямблии: обучающее и информационное видео

    Giardia кишечные (лямблии) являются наиболее распространенными кишечными паразитами, обнаруживаемыми у людей в Соединенных Штатах.

    Giardia lamblia/CDC

    Giardia — простейший паразит, живущий в кишечнике инфицированных людей и животных (в частности, бобров и домашних животных, таких как кошки и собаки). Он обнаруживается в окружающей среде на поверхностях (где он может сохраняться в течение длительного времени), воде и пищевых продуктах, загрязненных фекалиями инфицированного человека или животного.

    Дети заражаются чаще, чем взрослые. Как в небольших, так и в крупных общинных вспышках участвовали следующие лица:

    Лямблии представляют собой особую проблему в местах, где дети не приучены к туалету, например, в детских садах. В этих случаях игрушки и другие предметы, к которым прикасаются дети, могут загрязниться фекалиями (даже если их не видно). Следующий ребенок играет с игрушками и кладет палец в рот и так далее и тому подобное.

    Giardia также является проблемой в рекреационной воде, такой как бассейны, аквапарки, озера и ручьи.В местах, где маленькие дети плавают и могут испражняться в воду.

    Путешественники и отдыхающие могут подвергаться риску заражения, если пьют речную или озерную воду, которая может быть заражена инфицированными фекалиями человека или животных.

    Питьевая вода, использование льда, приготовленного из загрязненной воды, и употребление в пищу фруктов и овощей, вымытых в зараженной воде, — все это распространенные способы заражения паразитом, особенно во время поездок за границу.

    Иногда возникает проблема с колодезной водой, если колодец расположен у подножия холма или неглубокий из-за стока и паводковых вод, загрязняющих колодец.Кроме того, если колодезная вода находится на территории, где пасутся животные, а отходы жизнедеятельности животных загрязняют грунтовые воды. Бывают ситуации, когда тестирование на лямблии в колодезной воде оправдано.

    Хлорирование, как правило, неэффективно для уничтожения паразита Giardia, поэтому, если вы не можете избежать употребления потенциально зараженной воды, кипятите ее или фильтруйте с помощью фильтра, предназначенного для «удаления цист».

    Задокументированы также случаи передачи паразита половым путем (анально-орально).

    Большинство случаев Giardia, до 50%, протекают бессимптомно. Если вы заболели, симптомы Giardia обычно проявляются примерно через неделю после заражения. Симптомы можно разделить на легкие, острые и хронические инфекции.

    Легкая инфекция

    Обычно это умеренная диарея с последующим спонтанным выздоровлением через 6 недель.

    Острая инфекция

    Характеризуется внезапным появлением взрывоопасной водянистой диареи с неприятным запахом без крови и гноя, кишечных газов, спазмов в животе, тошноты, чрезмерной усталости, вздутия живота и озноба.Если не лечить, это может длиться недели или месяцы.

    Хроническая инфекция

    Хроническая инфекция часто характеризуется стеатореей, жирным, пенистым стулом, который плавает. Это связано с нарушением всасывания жиров.

    Диагноз Giardia традиционно ставится путем микроскопического исследования стула для выявления паразита. Из-за того, как выделяются лямблии, необходимо 3 отрицательных результата стула, чтобы исключить паразита.

    Существуют также тесты для выявления антигенов в кале или специальные иммунофлуоресцентные методы, которые, как правило, более чувствительны, чем микроскопическое исследование.

    Также посетите и отметьте «Нравится» страницу новостей об инфекционных заболеваниях в Facebook ЗДЕСЬ

     

    Солнечный фильтр из нанопроволоки и нанотрубок обеспечивает легкий доступ к чистой питьевой воде — ScienceDaily

    Даже сегодня чистая вода является привилегией для многих людей во всем мире. По данным Всемирной организации здравоохранения (ВОЗ), не менее 1,8 миллиарда человек потребляют воду, загрязненную фекалиями, и к 2040 году большая часть мира будет испытывать водный стресс из-за нехватки ресурсов питьевой воды.Между тем, по данным Детского фонда Организации Объединенных Наций (ЮНИСЕФ), около 1800 детей ежедневно умирают от диареи из-за небезопасного водоснабжения, вызывающего такие заболевания, как холера.

    Поэтому нам необходимо разработать эффективные и экономичные способы обеззараживания воды. И это именно то, чего добилась группа ученых во главе с Ласло Форро из EPFL, создав новый фильтр для очистки воды, который сочетает в себе нанопроволоки из диоксида титана (TiO 2 ) и углеродные нанотрубки, питаемые только солнечным светом.

    Ученые впервые показали, что нанопроволоки TiO 2 сами по себе могут эффективно очищать воду в присутствии солнечного света. Но переплетение нанопроволок с углеродными нанотрубками образует композитный материал, который добавляет дополнительный слой обеззараживания путем пастеризации воды, убивая патогены человека, такие как бактерии и крупные вирусы.

    Идея состоит в том, что когда ультрафиолетовый свет из видимого спектра солнечного света попадает на фильтр, он заставляет его производить группу молекул, называемых активными формами кислорода (АФК).К ним относятся перекись водорода (H 2 O 2 ), гидроксид (OH) и кислород (O 2 -), которые, как известно, являются эффективными убийцами патогенов.

    Исследователи протестировали свое устройство на бактериях E. Coli , являющихся «золотым стандартом» для исследований выживания бактерий, но оно должно работать и с другими патогенными бактериями, такими как Campylobacter Jejuni (часто вызывающий диарею патоген в развитые страны), Giardia Lamblia (микроорганизм, вызывающий кишечную инфекцию лямблиоз), Salmonella , Cryptosporidium (вызывает диарейный криптоспоридиоз), вирус гепатита А и Legionella Pneumophila (вызывает болезнь легионеров).Устройство отлично подходит для удаления всех патогенов из воды и показывает многообещающие результаты даже для удаления микрозагрязнителей, таких как пестициды, остатки лекарств, косметика и т. д.

    «В тесном сотрудничестве химиков, физиков и биологов мы разработали очень эффективное устройство для очистки воды, которому не нужен никакой источник энергии, кроме солнечного света», — говорит Форро. «Наш прототип может снабжать чистой питьевой водой небольшое население даже в отдаленных районах, и его можно легко масштабировать.Это большое достижение, и важным «побочным продуктом» этого проекта является то, что он привлек большое количество талантливых и целеустремленных студентов, которые заботятся об окружающей среде и об устойчивости».

    В своей статье, опубликованной в партнерском журнале Nature Clean Water , исследователи демонстрируют прототип фильтра и вносят предложения по дальнейшим улучшениям. «Я убежден, что это создаст сильное продолжение в различных научных сообществах и, надеюсь, в финансирующих агентствах», — говорит Эндре Хорват, ведущий ученый проекта.

    Источник истории:

    Материалы предоставлены Федеральной политехнической школой Лозанны . Оригинал написан Ником Папагеоргиу. Примечание. Содержимое можно редактировать по стилю и длине.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован.